Review



perfecthyb plus hybridization buffer  (Merck & Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Merck & Co perfecthyb plus hybridization buffer
    Perfecthyb Plus Hybridization Buffer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/perfecthyb+plus+hybridization+buffer/hybridization+buf/pm38565948-302-5-9
    Average 90 stars, based on 1 article reviews
    perfecthyb plus hybridization buffer - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Incubation:

    Article Title: HASTY , the Arabidopsis EXPORTIN5 ortholog, regulates cell‐to‐cell and vascular microRNA movement
    Article Snippet: Equal amounts of RNA (1 to 10 μg), dried with a vacuum concentrator, or immunoprecipitated RNA fractions were resuspended in Northern blot loading buffer (50% formamide, 10% glycerol, 10 mM Tris pH7.7, 1 mM EDTA, 0.01% bromophenol Blue), resolved by electrophoresis on a denaturating polyacrylamide gel (0.5X TBE, 17.5% acrylamide/bisacrylamide 19:1, 8 M urea), transferred on a Hybond‐NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross‐linked using 1‐ethyl‐3‐(3‐dimethylaminopropyl)carbodiimide (EDC) according to Pall and Hamilton ( ) for 2 h at 60°C. .. Membranes were incubated in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42°C overnight with an oligonucleotide probe complementary to a specific miRNA sequence and 5’‐end‐labeled with [γ‐ 32 P]ATP using T4 PNK (Thermo Fisher Scientific). ..

    Article Title: An AGO10:miR165/6 module regulates meristem activity and xylem development in the Arabidopsis root.
    Article Snippet: RNA was transferred on a Hybond-NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross-linked using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), according to (Pall and Hamilton, 2008), for 2 h at 60 °C. .. Membranes were incubated overnight in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42 °C, with an oligonucleotide probe 5’-end labeled with [γ-32P]ATP using T4 PNK (Thermo Fisher Scientific) and complementary to the specified miRNA sequence. ..

    Hybridization:

    Article Title: HASTY , the Arabidopsis EXPORTIN5 ortholog, regulates cell‐to‐cell and vascular microRNA movement
    Article Snippet: Equal amounts of RNA (1 to 10 μg), dried with a vacuum concentrator, or immunoprecipitated RNA fractions were resuspended in Northern blot loading buffer (50% formamide, 10% glycerol, 10 mM Tris pH7.7, 1 mM EDTA, 0.01% bromophenol Blue), resolved by electrophoresis on a denaturating polyacrylamide gel (0.5X TBE, 17.5% acrylamide/bisacrylamide 19:1, 8 M urea), transferred on a Hybond‐NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross‐linked using 1‐ethyl‐3‐(3‐dimethylaminopropyl)carbodiimide (EDC) according to Pall and Hamilton ( ) for 2 h at 60°C. .. Membranes were incubated in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42°C overnight with an oligonucleotide probe complementary to a specific miRNA sequence and 5’‐end‐labeled with [γ‐ 32 P]ATP using T4 PNK (Thermo Fisher Scientific). ..

    Article Title: An AGO10:miR165/6 module regulates meristem activity and xylem development in the Arabidopsis root.
    Article Snippet: RNA was transferred on a Hybond-NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross-linked using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), according to (Pall and Hamilton, 2008), for 2 h at 60 °C. .. Membranes were incubated overnight in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42 °C, with an oligonucleotide probe 5’-end labeled with [γ-32P]ATP using T4 PNK (Thermo Fisher Scientific) and complementary to the specified miRNA sequence. ..

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    Article Title: Mammalian RNase H1 directs RNA primer formation for mtDNA replication initiation and is also necessary for mtDNA replication completion
    Article Snippet: .. Amersham ECL Western Blotting Detection Reagent GE Healthcare Cat# RPN2106 anti-AIF Abcam Cat# ab16501 anti-GAPDH Abcam Cat# ab8245 anti-Histone 3 Sigma Aldrich Cat# H0164 anti-HSP60 Enzo Life Cat# ADI-SPA-807-E anti-LRPPRC Sigma Aldrich Cat# HPA 036409 anti-mouse IgG horseradish peroxidase GE Healthcare Cat# NA9310V anti-OXPHOS human Abcam Cat# ab110411 anti-OXPHOS rodent Abcam Cat# ab110413 anti-rabbit IgG horseradish peroxidase GE Healthcare Cat# NA9340V anti-RNase H1 Proteintech Cat# 15606-1-AP anti-TFAM Abcam Cat# ab131607 anti-TIM 22 Proteintech Cat# 14927-1-AP anti-TOM 20 Cell Signalling Cat# 13929S anti-VDAC Abcam Cat# ab14734 BamHI New England Biolabs Cat# R0136S BclI New England Biolabs Cat# R0160S Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 EcoRI New England Biolabs Cat# R0101S Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicilin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Iodonitrotetrazolium chloride Merck Cat# I10406 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 Purified anti-POLRMT N.-G.Larsson Kuhl et al, 2014 Rapid hyb Buffer Cytiva Cat# RPN1635 SacI-HF New England Biolabs Cat# R3156S XhoI New Englands Biolabs R0146S EagI-HF New Englands Biolabs R3505S BclII New Englands Biolabs R0144S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat#15596026 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 RNase H New England Biolabs Cat# M0297S Human PolG A&B Posse et al, 2019 N/A Human RNase H1 and mutants Al-Behadili et al, 2018, this work N/A Human POLRMT Posse et al, 2019 N/A Human TFB2M Posse et al, 2019 N/A Human mtSSB Posse et al, 2019 N/A Human TFAM Posse et al, 2019 N/A .. Cell Fractionation Kit Abcam Cat# ab109719 Gentra Puregene Tissue Kit Qiagen Cat# 158667) High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368813 miRNeasy Mini Kit Qiagen Cat# 217004 Prime-It II Random Primer Labeling Kit Agilent Cat# 300385 TaqManTM Universal Master Mix II, with UNG Thermo Fisher Scientific Cat# 4440038 TURBO DNA-freeTM Kit Thermo Fisher Scientific Cat# AM1907

    Sequencing:

    Article Title: HASTY , the Arabidopsis EXPORTIN5 ortholog, regulates cell‐to‐cell and vascular microRNA movement
    Article Snippet: Equal amounts of RNA (1 to 10 μg), dried with a vacuum concentrator, or immunoprecipitated RNA fractions were resuspended in Northern blot loading buffer (50% formamide, 10% glycerol, 10 mM Tris pH7.7, 1 mM EDTA, 0.01% bromophenol Blue), resolved by electrophoresis on a denaturating polyacrylamide gel (0.5X TBE, 17.5% acrylamide/bisacrylamide 19:1, 8 M urea), transferred on a Hybond‐NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross‐linked using 1‐ethyl‐3‐(3‐dimethylaminopropyl)carbodiimide (EDC) according to Pall and Hamilton ( ) for 2 h at 60°C. .. Membranes were incubated in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42°C overnight with an oligonucleotide probe complementary to a specific miRNA sequence and 5’‐end‐labeled with [γ‐ 32 P]ATP using T4 PNK (Thermo Fisher Scientific). ..

    Article Title: An AGO10:miR165/6 module regulates meristem activity and xylem development in the Arabidopsis root.
    Article Snippet: RNA was transferred on a Hybond-NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross-linked using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), according to (Pall and Hamilton, 2008), for 2 h at 60 °C. .. Membranes were incubated overnight in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42 °C, with an oligonucleotide probe 5’-end labeled with [γ-32P]ATP using T4 PNK (Thermo Fisher Scientific) and complementary to the specified miRNA sequence. ..

    Labeling:

    Article Title: An AGO10:miR165/6 module regulates meristem activity and xylem development in the Arabidopsis root.
    Article Snippet: RNA was transferred on a Hybond-NX Nylon membrane (Merck Sigma) in 0.5X TBE, and cross-linked using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), according to (Pall and Hamilton, 2008), for 2 h at 60 °C. .. Membranes were incubated overnight in PerfectHyb Plus Hybridization buffer (Merck Sigma) at 42 °C, with an oligonucleotide probe 5’-end labeled with [γ-32P]ATP using T4 PNK (Thermo Fisher Scientific) and complementary to the specified miRNA sequence. ..

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    Magnetic Beads:

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    Chromatin Immunoprecipitation:

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    cDNA Synthesis:

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    SYBR Green Assay:

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    Mutagenesis:

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    Footprinting:

    Article Title: Frequent promoter hypermethylation and down regulation of BNIP3: An early event during gallbladder cancer progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 488-Goat anti-rabbit Thermo Fisher Scientific Cat# R37116; RRID: AB_2556544 555-Donkey anti-mouse Thermo Fisher Scientific Cat# A-31570; RRID:AB_2536180 594-Goat anti-rabbit Cell Signaling Technology Cat# 8889; RRID:AB_2716249 Goat anti-mouse IgM Alexa 594 Thermo Fisher Scientific Cat# A-21044; RRID:AB_2535713 Goat anti-rabbit Atto647N Sigma Aldrich Cat# 40839; RRID:AB_1137669 HRP-Goat anti-rabbit Thermo Fisher Scientific Cat# 65-6120; RRID:AB_2533967 HRP-Sheep anti-mouse Cytiva Cat# NXA931, RRID:AB_772209 Mouse anti-BrU Merck Cat# QIA58 Mouse anti-COXIV Cell Signaling Technology Cat# 11967; RRID:AB_2797784 Mouse anti-dsDNA Santa Cruz Biotechnology Cat# sc-58749; RRID:AB_783088 Mouse IgM anti-DNA Progen Cat# 61014; RRID:AB_2750935 Mouse anti-VDAC1 Abcam Cat# ab14734; RRID:AB_443084 Rabbit anti-POLRMT Thermo Fisher Scientific Cat# PA5-28196; RRID:AB_2545672 Rabbit anti-COXIV Cell Signaling Technology Cat# 4850; RRID:AB_2085424 Rabbit anti-DIG Thermo Fisher Scientific Cat# 700772; RRID:AB_2532342 Rabbit anti-TOM20 Santa Cruz Cat# sc-11415; RRID:AB_2207533 Control siRNA #1 Horizon Cat# D-001810-01 Control siRNA #2 Horizon Cat# D-001810-02 SUV3 siRNA Horizon Cat# M-017841-010 PNPT1 siRNA Horizon Cat# M-019454-010 mtRNA metabolism library, see Table S3 Horizon N/A Chemicals, peptides, and recombinant proteins 16% Formaldehyde Thermo Fisher Scientific Cat# 28908 5’-Bromouridine Merck Cat# 850187 ATTO488-dUTP Jena Bioscience Cat# PP-305L-488 ATTO550-dUTP Jena Bioscience Cat# NU-803-550 BamHI New England Biolabs Cat# R0136S HindIII New England Biolabs Cat# R0104S DAPI Thermo Fisher Scientific Cat# D1306 Dextran Sulfate Merck Cat# D8906 Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 Dynabeads Goat Anti-Mouse IgG Thermo Fisher Scientific Cat# 11033 Fixogum Rubber Cement MP Biomedicals Cat# FIXO0125 Formamide (Deionized) Thermo Fisher Scientific Cat# AM9344 Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicillin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Human 7S RNA probe Thermo Fisher Scientific cat# VPNKRHA Human POLRMT Falkenberg et al. (2002) N/A Human TFAM Falkenberg et al. (2002) N/A Human TFB2M Falkenberg et al. (2002) N/A Human TEFM Posse et al. (2015) N/A Iodonitrotetrazolium chloride Merck Cat# I10406 (Continued on next page) e1 Cell 185, 2309–2323.e1–e10, June 23, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER KOD DNA polymerase Merck Cat# 71085 Lipofectamine RNAiMAX Thermo Fisher Scientific Cat# 13778030 Murine RNase Inhibitor New England Biolabs Cat# M0314 Opti-MEM Thermo Fisher Scientific Cat# 11058021 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 ProLong Diamond Antifade Thermo Fisher Scientific Cat# P36970 HiScribe T7 RNA Polymerase kit New England Biolabs Cat# E2040S RNA sample loading dye Merck Cat# R1386 RNase A Thermo Fisher Scientific Cat# EN0531 RNase H New England Biolabs Cat# M0297 RNase T1 Fermentas Cat# EN0541 Salmon Sperm DNA Merck Cat# D7656 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 E.coli Poly A polymerase New England Biolabs Cat# M0276L Oligo d(T)25 Magnetic Beads New England Biolabs Cat# S1419S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat# 15596026 Tween-20 Merck P7949 a-32P-UTP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-210 g-32P-ATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-301 a-32P-dATP (3000 Ci/mmol) Hartmann Analytic GmbH Cat# SRP-203 Critical commercial assays ChIP DNA Clean & Concentrator Zymo Cat# D5201 Genomic DNA Clean & Concentrator Zymo Cat# D4011 iScript Select cDNA Synthesis Kit BioRad Cat# 1708897 iTaq Universal SYBR Green Supermix BioRad Cat# #1725121 Prime-IT II Random Primer Labeling kit Agilent Technologies Cat# 300385 Quick-RNA miniprep Zymo Cat# R1055 QuickChange Lighting Multi site-directed mutagenesis kit Agilent Technologies Cat# 210514 HighYield T7 Atto488 RNA Labeling Kit Jena Bioscience Cat#RNT-101-488-S TURBO DNA-free DNase kit Thermo Fisher Scientific Cat# AM1907 Deposited data Protein structure PDB ID EMD ID POLRMT dimer 7PZP 13735 POLRMT apo 7PZR 13736 POLRMT mutant 7ZC4 14619 Experimental models: Cell lines Human: HeLa cells ATCC ATCC CCL-2 T7_7S_F(7S RNA synthesis): GCCGCGTAATACGACTCACTATAGG AGATAAAATTTG Eurofins Custom primer T7_7S_R(7S RNA synthesis): ATGCTTGTAGGACATAATAATAACAATTGAATG Eurofins Custom primer LSPFP_F (DNase footprinting): GCACTTAAACACATCTCTGCCAAACCCC Eurofins Custom primer LSPFP_R (DNase footprinting): GTAAAACGACGGCCAGTGCCAAGC Eurofins Custom primer Oligonucleotides used in this study Table S4 N/A (Continued on next page) ll OPEN ACCESS Cell 185, 2309–2323.e1–e10, June 23, 2022 e2 Article ..

    Western Blot:

    Article Title: Mammalian RNase H1 directs RNA primer formation for mtDNA replication initiation and is also necessary for mtDNA replication completion
    Article Snippet: .. Amersham ECL Western Blotting Detection Reagent GE Healthcare Cat# RPN2106 anti-AIF Abcam Cat# ab16501 anti-GAPDH Abcam Cat# ab8245 anti-Histone 3 Sigma Aldrich Cat# H0164 anti-HSP60 Enzo Life Cat# ADI-SPA-807-E anti-LRPPRC Sigma Aldrich Cat# HPA 036409 anti-mouse IgG horseradish peroxidase GE Healthcare Cat# NA9310V anti-OXPHOS human Abcam Cat# ab110411 anti-OXPHOS rodent Abcam Cat# ab110413 anti-rabbit IgG horseradish peroxidase GE Healthcare Cat# NA9340V anti-RNase H1 Proteintech Cat# 15606-1-AP anti-TFAM Abcam Cat# ab131607 anti-TIM 22 Proteintech Cat# 14927-1-AP anti-TOM 20 Cell Signalling Cat# 13929S anti-VDAC Abcam Cat# ab14734 BamHI New England Biolabs Cat# R0136S BclI New England Biolabs Cat# R0160S Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 EcoRI New England Biolabs Cat# R0101S Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicilin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Iodonitrotetrazolium chloride Merck Cat# I10406 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 Purified anti-POLRMT N.-G.Larsson Kuhl et al, 2014 Rapid hyb Buffer Cytiva Cat# RPN1635 SacI-HF New England Biolabs Cat# R3156S XhoI New Englands Biolabs R0146S EagI-HF New Englands Biolabs R3505S BclII New Englands Biolabs R0144S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat#15596026 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 RNase H New England Biolabs Cat# M0297S Human PolG A&B Posse et al, 2019 N/A Human RNase H1 and mutants Al-Behadili et al, 2018, this work N/A Human POLRMT Posse et al, 2019 N/A Human TFB2M Posse et al, 2019 N/A Human mtSSB Posse et al, 2019 N/A Human TFAM Posse et al, 2019 N/A .. Cell Fractionation Kit Abcam Cat# ab109719 Gentra Puregene Tissue Kit Qiagen Cat# 158667) High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368813 miRNeasy Mini Kit Qiagen Cat# 217004 Prime-It II Random Primer Labeling Kit Agilent Cat# 300385 TaqManTM Universal Master Mix II, with UNG Thermo Fisher Scientific Cat# 4440038 TURBO DNA-freeTM Kit Thermo Fisher Scientific Cat# AM1907

    Purification:

    Article Title: Mammalian RNase H1 directs RNA primer formation for mtDNA replication initiation and is also necessary for mtDNA replication completion
    Article Snippet: .. Amersham ECL Western Blotting Detection Reagent GE Healthcare Cat# RPN2106 anti-AIF Abcam Cat# ab16501 anti-GAPDH Abcam Cat# ab8245 anti-Histone 3 Sigma Aldrich Cat# H0164 anti-HSP60 Enzo Life Cat# ADI-SPA-807-E anti-LRPPRC Sigma Aldrich Cat# HPA 036409 anti-mouse IgG horseradish peroxidase GE Healthcare Cat# NA9310V anti-OXPHOS human Abcam Cat# ab110411 anti-OXPHOS rodent Abcam Cat# ab110413 anti-rabbit IgG horseradish peroxidase GE Healthcare Cat# NA9340V anti-RNase H1 Proteintech Cat# 15606-1-AP anti-TFAM Abcam Cat# ab131607 anti-TIM 22 Proteintech Cat# 14927-1-AP anti-TOM 20 Cell Signalling Cat# 13929S anti-VDAC Abcam Cat# ab14734 BamHI New England Biolabs Cat# R0136S BclI New England Biolabs Cat# R0160S Digitonin Merck Cat# 300410 DMEM GlutaMAX Thermo Fisher Scientific Cat# 31966021 EcoRI New England Biolabs Cat# R0101S Gibco Fetal Bovine Serum Thermo Fisher Scientific Cat# 10500064 Gibco Penicilin/Streptomycin Thermo Fisher Scientific Cat# 15-140-122 Iodonitrotetrazolium chloride Merck Cat# I10406 PerfectHyb Plus Hybridization buffer Merck Cat# H7033 Purified anti-POLRMT N.-G.Larsson Kuhl et al, 2014 Rapid hyb Buffer Cytiva Cat# RPN1635 SacI-HF New England Biolabs Cat# R3156S XhoI New Englands Biolabs R0146S EagI-HF New Englands Biolabs R3505S BclII New Englands Biolabs R0144S Triton X-100 Merck Cat# T8787 Trizol reagent Thermo Fisher Scientific Cat#15596026 T4 Polynucleotide Kinase New England Biolabs Cat# M0201 RNase H New England Biolabs Cat# M0297S Human PolG A&B Posse et al, 2019 N/A Human RNase H1 and mutants Al-Behadili et al, 2018, this work N/A Human POLRMT Posse et al, 2019 N/A Human TFB2M Posse et al, 2019 N/A Human mtSSB Posse et al, 2019 N/A Human TFAM Posse et al, 2019 N/A .. Cell Fractionation Kit Abcam Cat# ab109719 Gentra Puregene Tissue Kit Qiagen Cat# 158667) High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368813 miRNeasy Mini Kit Qiagen Cat# 217004 Prime-It II Random Primer Labeling Kit Agilent Cat# 300385 TaqManTM Universal Master Mix II, with UNG Thermo Fisher Scientific Cat# 4440038 TURBO DNA-freeTM Kit Thermo Fisher Scientific Cat# AM1907



    Similar Products

    perfecthyb plus hybridization buffer  (Millipore)
    90
    Millipore perfecthyb plus hybridization buffer
    Perfecthyb Plus Hybridization Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/perfecthyb+plus+hybridization+buffer/perfecthyb+plus+hybridization+buffer/pm39922193-202-6-10
    Average 90 stars, based on 1 article reviews
    perfecthyb plus hybridization buffer - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    perfecthyb plus hybridization buffer  (Merck & Co)
    90
    Merck & Co perfecthyb plus hybridization buffer
    Perfecthyb Plus Hybridization Buffer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/perfecthyb+plus+hybridization+buffer/hybridization+buf/pm38565948-302-5-9
    Average 90 stars, based on 1 article reviews
    perfecthyb plus hybridization buffer - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    perfecthyb™ plus hybridization buffer  (Millipore)
    90
    Millipore perfecthyb™ plus hybridization buffer
    Perfecthyb™ Plus Hybridization Buffer, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/perfecthyb+plus+hybridization+buffer/perfecthyb+plus+hybridization+buffer/10__3390_slash_ijpb15010011-98-23-27
    Average 90 stars, based on 1 article reviews
    perfecthyb™ plus hybridization buffer - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results